termoablacja ultradźwiękowa

Ból w karku

W artykule Clinical Problem-Solving autorstwa Bliss i in. (Wydanie 4 marca), które dotyczyło zespołu Lemierre a, dyskutant wspomina o wysięku migdałkowym pacjenta, gorączce, adenopatii przedniej szyjki macicy i braku kaszlu. . . są wysoce sugerujące paciorkowcowe zapalenie gardła i że należy uzyskać wymaz z jej gardła w celu szybkiego testu antygenu paciorkowcowego . Ostatnie wytyczne i badania...

Nieinwazyjna wentylacja z dodatnim ciśnieniem w przypadku niewydolności oddechowej po ekstubacji ad

Keenan i wsp. [14] nie wykazali różnicy w częstości reaktywacji lub śmiertelności z zastosowaniem nieinwazyjnej wentylacji nadciśnieniowej w porównaniu ze standardową terapią medyczną u pacjentów z niewydolnością oddechową w ciągu 48 godzin po ekstubacji. Ich badanie było stosunkowo małym, jednoośrodkowym badaniem, w którym oceniano szybkość reintubacji jako główny punkt końcowy. Stopień, w jakim...

Factorial Trial z sześciu interwencji w celu zapobiegania pooperacyjnych nudności i wymiotów ad

Alternatywnie, unikanie czynników emetogennych podczas znieczulenia może zmniejszyć podstawowe ryzyko nudności pooperacyjnych i wymiotów. Strategia ta obejmuje stosowanie propofolu zamiast lotnych środków znieczulających, zastępowanie azotu podtlenkiem azotu i stosowanie remifentanilu, opioidu o bardzo krótkim czasie działania, zamiast fentanylu. Ograniczona skuteczność leczenia pojedynczym lekiem przeciwwym...

termoablacja ultradźwiękowa

W niniejszym raporcie definiujemy parametry ludzkiej odpowiedzi immunologicznej po immunizacji szczepionką przeciw wirusowemu zapaleniu wątroby typu B. 2 tygodnie po immunizacji przypominającej stwierdzono znaczne spontaniczne wydzielanie przeciwciała do antygenu powierzchniowego wirusa zapalenia wątroby typu B (anty-HBs IgG), które nie jest dodatkowo wzmacniane przez stymulację antygenem lub mitogenem szkarłatki ...

Najnowsze zdjęcia w galerii termoablacja ultradźwiękowa :



Infekcje Clostridium związane z alloprzeszczepami mięśniowo-szkieletowymi ad 5

Nieautomowane metody hodowli bulionowej wykorzystano przed wrześniem 2001 r. Identyfikacja izolatów została przeprowadzona przez Tissue Bank A; nie wszystkie izolaty zostały w pełni zidentyfikowane. Bank tkanek A nie rutynowo mierzył obciążenia mikrobiologiczne (hodowle ilościowe) przychodzących tkanek iw 1995 r. Zaprzestał wykonywania jakościowych hodowli tkanek przed wystawieniem ich na działanie przeciwdro...

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą A...

Infekcje Clostridium związane z alloprzeszczepami mięśniowo-szkieletowymi

Alloprzeszczepy są powszechnie stosowane w chirurgii rekonstrukcyjnej ortopedycznej. W 2001 r. Około 775 000 alloprzeszczepów mięśniowo-szkieletowych zostało rozprowadzonych przez amerykańskie banki tkanek. Po śmierci z powodu sepsy Clostridium sordellii 23-letniego mężczyzny, który otrzymał skażony allograft z banku tkanek (Tissue Bank A), Centers for Disease Control and Prevention zainicjowały badanie, w t...