Pemfigoid bliznowaciejący

26-letni mężczyzna miał pęcherze i nadżerki, które rozwinęły się na języku przez 48 godzin (panel A). Pęcherze pojawiły się przede wszystkim w jego ustach, ale kilka pojawiło się również na jego twarzy i tułowiu. Nie było zaangażowania jego oczu. Głównym powikłaniem było bliznowacenie krtani z powodu tworzenia pęcherzy. Dwa lata przed tą prezentacją biopsja wykazała naciek eozynofilów w bańce podnaskórkowej. Bezpośrednia immunofluorescencja próbki biopsyjnej wykazała liniowe odkładanie IgG na błonie podstawnej. Te wyniki były zgodne z rozpoznaniem pemfigoidu bliznowatego. W przy...

Rak grasicy z nadekspresją zmutowanego zestawu i reakcją na imatynib

Metastatyczny rak grasicy u pacjenta z aktywującym zestawem mutacyjnym, przed leczeniem imatinibem (panel A, hematoksylina i eozyna, x 400, panel B, barwienie immunohistochemiczne Ki-67, x 400). W kwietniu 2002 r. 54-letni mężczyzna cierpiał na bóle klatki piersiowej i zaburzenia oddechowe; masę śródpiersia, 7,7 na 6 cm, znaleziono na tomografii emisyjnej pozytronowej i tomografii komputerowej. Dalsze badania wykazały podwyższony poziom enzymów wątrobowych i liczne przerzuty do wątroby. Biopsja wątroby wykazała przerzutowy, słabo zróżnicowany rak naskórkowy grasicy, z silną ekspresją KIT (Ryc. ...

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700 Sequence Detection Analyzer (Applied Biosystems). Wszystkie próbki DNA poddano również ilościowej PCR w czasie rzeczywistym dla genu .-globiny, który służył jako kontrola w zakresie, w ja...

Zobacz też:

tasiemiec szczurzy tasiemiec uzbrojony objawy termoablacja ultradźwiękowa test inteligencji emocjonalnej golemana tęgoryjec dwunastnicy objawy trigeminia komorowa arcania gothic 4 crack ucisk worka oponowego udar pnia mózgu rokowania utajona niedoczynność tarczycy wafle ryżowe ig wodniak jądra u dorosłych wole guzowate tarczycy worek oponowy kręgosłupa wypuklina krążka międzykręgowego leczenie wyszukiwarka kodów icd 10 za krotkie wedzidelko za mało neutrocytów zagrzybiony organizm objawy zakwaszenie organizmu mit cubase 7 crack

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli ad 7

Ponadto odpowiedź na chemioterapię miała znaczący wpływ na przeżycie całkowite (p = 0,04 dla porównania pomiędzy pacjentami z całkowitą odpowiedzią i tymi z częściową odpowiedzią), ale nie na przeżyciu wolnym od nawrotów (p = 0,12). Wiek, płeć, typ patologiczny, status sprawności Karnofsky ego, poziom DNA EBV w osoczu podczas i po zakończeniu chemioterapii, stadium T, stadium N i ogólny etap nie miały istotnego wpływu na przeżycie całkowite lub czas wolny od nawrotu. Całkowity czas przeżycia po dwóch latach wyniósł 100% wśród pacjentów, u których stężenie EBV DNA w surowicy przed leczeniem...

Najnowsze zdjęcia w galerii 5dniwojny:

300#trigeminia komorowa , #arcania gothic 4 crack , #ucisk worka oponowego , #udar pnia mózgu rokowania , #utajona niedoczynność tarczycy , #wafle ryżowe ig , #wodniak jądra u dorosłych , #wole guzowate tarczycy , #worek oponowy kręgosłupa , #wypuklina krążka międzykręgowego leczenie ,