Komórki śródbłonka naczyń nerkowych w nerkach wyrażają wielospecyficzny receptor chemokin, który jest strukturalnie i funkcjonalnie identyczny z izoformą erytroidalną, która jest antygenem grupy krwi Duffy.

Ostatnio wykazano, że ludzki receptor erytrocytów chemokin jest identyczny z antygenem grupy krwi Duffy i jest wyrażany w wielu narządach, w tym w nerkach. Tutaj zbadaliśmy właściwości molekularne izoformy nerek. Analiza immunoblot lizatów erytrocytów i detergentów nerek, z przeciwciałem monoklonalnym (Fy6) do antygenu Duffy, ujawniła, że izoforma nerek miała masę cząsteczkową 43-45 kD, którą można było odróżnić od obserwowanej w komórkach erytroidalnych (38-47). kD). Chemiczne sieciowanie błon nerek ...

Pomiar trombiny we krwi krzepnięcia metodą radioimmunologiczną.

Opracowaliśmy test radioimmunologiczny na trombinę ludzką z użyciem króliczej przeciw trombiny IgG przeciwko ludzkiej. Test może mierzyć 2 ng trombiny / ml osocza, 500-krotnie bardziej czułe niż testy krzepnięcia. Ludzka protrombina jest mniej reaktywna w teście niż trombina co najmniej o cztery rzędy wielkości i nie ma zademonstrowanej reaktywności krzyżowej z ludzkim czynnikiem Xa, czynnikiem krzepnięcia strukturalnie najbardziej podobnym do trombiny. Test nie wykrywa trombiny związanej z antrotrombiną III....

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli czesc 4

Spośród 101 pacjentów 2 pacjentów, którzy przerwali radioterapię przedwcześnie po otrzymaniu 24 i 34 Gy, zostali wykluczeni z dalszych analiz. W tabeli wymieniono charakterystykę wstępnego leczenia pozostałych 99 pacjentów i ich guzów. Po zakończeniu chemioterapii 59 pacjentów (60 procent) miało pełną odpowiedź kliniczną, a 40 (40 procent) miało częściową odpowiedź. Druga biopsja pierwotnego miejsca guza została przeprowadzona przed radioterapią u 97 pacjentów, z których 65 miało patologicznie peł...

Czy wysokoopłacalne plany zdrowotne zagrażają jakości opieki ad

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700 Sequence Detection Analyzer (Applied Biosystems). Wszystkie próbki DNA poddano również ilo...

Najnowsze zdjęcia w galerii 5dniwojny:

238#udar pnia mózgu rokowania , #gothic 4 pl torrent , #wafle ryżowe ig , #maczeta allegro , #wole guzowate tarczycy , #worek oponowy kręgosłupa , #allegro askas77 , #wyszukiwarka kodów icd 10 , #za krotkie wedzidelko , #gothic 4 torrent ,