kreatynina w surowicy krwi

Retinopatia cukrzycowa

W artykule przeglądowym dotyczącym retinopatii cukrzycowej (numer stycznia), Frank stwierdził, że mechanizm wywoływania efektu panretinalu lub rozpraszania laserem w retinopatii cukrzycowej jest niejasny. Na poparcie tego wniosku zacytowano dwa odniesienia, od 1978 do 1982 roku.
Artykuł przeglądowy ignoruje znaczną literaturę dotyczącą fizjologicznego mechanizmu leczenia laserowego siatkówki proliferacyjnej retinopatii cukrzycowej i cukrzycowego obrzęku pl...

Więcej »

Rak grasicy z nadekspresją zmutowanego zestawu i reakcją na imatynib

Metastatyczny rak grasicy u pacjenta z aktywującym zestawem mutacyjnym, przed leczeniem imatinibem (panel A, hematoksylina i eozyna, x 400, panel B, barwienie immunohistochemiczne Ki-67, x 400). W kwietniu 2002 r. 54-letni mężczyzna cierpiał na bóle klatki piersiowej i zaburzenia oddechowe; masę śródpiersia, 7,7 na 6 cm, znaleziono na tomografii emisyjnej pozytronowej i tomografii komputerowej. Dalsze badania wykazały podwyższony poziom enzymów wątrobowych i licz...

Więcej »

LMO2 i Gene Therapy dla ciężkiego złożonego niedoboru odporności

McCormack i Rabbitts (wydanie z 26 lutego) omawiają rolę aktywacji onkogenu LMO2 komórek T w indukowaniu klonalnej proliferacji komórek T u dwóch pacjentów po terapii genowej związanej z ciężkim złożonym niedoborem odporności związanym z chromosomem X (SCID), stan spowodowany przez mutacja genu podjednostki receptora .c cytokiny. Autorzy wskazują na rolę .c jako kofaktora proliferacji klonalnej. Nie ma jednak danych sugerujących, że zgodnie z propozycją eksp...

Więcej »

Codzienne przerwanie uspokajających infuzji u pacjentów z krytyczną chorobą poddawanych mechanicznej wentylacji ad 5

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700 Sequence Detection Analyzer (Applied Bios...

Więcej »
http://www.emedycyna-estetyczna.com.pl 751#paweł bednarz mielec , #schizofrenia paranoidalna czy jest dziedziczna , #yerba mate działanie negatywne , #pleśniawka na ustach , #winogrono białe kalorie , #łóżeczka dziecięce wymiary , #maseczka zielona glinka , #metody na zaparcia , #pompki na krzesłach , #bransoletki rossmann ,