Warning: file(http://tymek10.nazwa.pl/statlink/ender_blogi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra15/ftp/5dniwojny.pl/media/data.php on line 27

Warning: file(http://tymek10.nazwa.pl/statlink/ender_tagi.txt): failed to open stream: HTTP request failed! HTTP/1.1 404 Not Found in /home/hydra15/ftp/5dniwojny.pl/media/data.php on line 28
radosław blok

radosław blok

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli ad 6

Tylko 10 z 99 pacjentów miało wykrywalne stężenie DNA EBV w swoim osoczu w tym czasie (mediana, 121 kopii na mililitr, zakres od 8 do 5066). Siedmiu z tych 10 pacjentów miało później nawrót: 6 miało tylko odległe przerzuty, a miało odległe przerzuty i nawrót w szyi. Nie było związku między stężeniem DNA EBV tydzień po zakończeniu radioterapii a ryzykiem nawrotu u tych 10 pacjentów. Łącznie 130 próbek krwi uzyskano od 68 pacjentó...

Więcej »

Bevacizumab plus irinotekan, fluorouracyl i leukoworyna z powodu przerzutowego raka jelita grubego ad

Wystarczająca była również odpowiednia funkcja hematologiczna, wątrobowa i nerek (w tym wydalanie z moczem nie więcej niż 500 mg białka dziennie). Kryteria wykluczenia obejmowały wcześniejszą chemioterapię lub biologiczną terapię z powodu choroby przerzutowej (adjuwantowe lub radiotropowe stosowanie fluoropirymidyn z lub bez leukoworyny lub lewamizolu ponad 12 miesięcy przed wejściem na studia było dozwolone), przyjęcie radioterapii w c...

Więcej »

Defekty wiążące prostacyklinę w zakrzepowej plamie małopłytkowej.

Aby zrozumieć patofizjologiczne znaczenie nieprawidłowej aktywności wiązania prostacykliny (PGI2) w zakrzepowej plamie małopłytkowej (TTP), oceniliśmy charakterystykę wiązania PGI2 w trzech przewlekłych surowicach TTP i 19 prawidłowych surowicach. Wiązanie PGI2 przez surowicę było szybkie i odwracalne. Aktywność wiązania w surowicach TTP (22,1 +/- SD, 4,4%) była znacznie niższa niż w przypadku normalnych surowic (42,2 . 6,2%). Ponadto ...

Więcej »

Neuropsychiatria urazowego uszkodzenia mózgu ad

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700 Sequence Detection A...

Więcej »
http://www.tanie-odwierty.com.pl 751#schizofrenia paranoidalna czy jest dziedziczna , #yerba mate działanie negatywne , #pleśniawka na ustach , #winogrono białe kalorie , #łóżeczka dziecięce wymiary , #maseczka zielona glinka , #metody na zaparcia , #pompki na krzesłach , #bransoletki rossmann , #8 gb to mb ,