Synteza niezbędnych aminokwasów z ich analogów (3-ketonowych za pomocą perfuzji wątroby i mięśni szczura

Większość niezbędnych aminokwasów można zastąpić ich (3-keto-analogami w diecie. Te ketokwasy zostały zatem zaproponowane jako substytuty białka dietetycznego. W celu określenia ich losu w tkankach zdrowych zwierząt wyizolowane preparaty wątroby szczura i łokciowej (mięśniowej) perfundowano keto-analogami waliny, leucyny, izoleucyny, metioniny lub fenyloalaniny. Gdy perfundowano przy 1,5-2,0 mM, wszystkie pięć związków było szybko wykorzystywa...

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700 Sequence Detection Analyzer (...

Pokarm bogaty w purytę i ryzyko dny moczanowej u mężczyzn

Choi i in. (Wydanie z 11 marca) badał dietę w odniesieniu do dny moczanowej, ale nie kontrolował stosowania aspiryny lub diuretyków. Te środki są używane przez bardzo dużą liczbę osób. Podnoszą poziom kwasu moczowego i powodują dnę.
J. Lawrence Dohan, MD
Marlborough Hospital, Marlborough, MA 01752
Odniesienie1. Choi HK, Atkinson K, Karlson EW, Willett W, Curhan G. Żywność bogata w purynę, nabiał i białko, a takż...

Przeniesienie genu antybiotyku peptydowego katelicydyny przywraca zabijanie bakterii w modelu heteroprzeszczepu mukowiscydozy 4

Poprzednie badania z tego laboratorium i innych na szczurach, małpach i ludziach wspierają koncepcję, że hormon wzrostu (GH) może regulować własne wydzielanie przez mechanizm autofeedbacku. Wraz z dostępnością ludzkiego czynnika uwalniającego hormon wzrostu (GRF), możliwe istnienie takiego mechanizmu zostało ponownie zbadane przez zbadanie wpływu egzogennego GH na odpowiedź GH indukowaną przez GRF-44-NH2 u sześciu zdrowych mężczyzn (średni wiek...

Najnowsze zdjęcia w galerii 5dniwojny:

238#tasiemiec uzbrojony objawy , #termoablacja ultradźwiękowa , #test inteligencji emocjonalnej golemana , #noże fiskars allegro , #trigeminia komorowa , #arcania gothic 4 crack , #ucisk worka oponowego , #udar pnia mózgu rokowania , #gothic 4 pl torrent , #wafle ryżowe ig ,