PIC-748

Factorial Trial z sześciu interwencji w celu zapobiegania pooperacyjnych nudności i wymiotów czesc 4

Po 2 i 24 godzinach po operacji, przeszkoleni badacze, którzy byli całkowicie zaślepieni śródoperacyjnym zarządzaniem i losowymi zadaniami leczenia, odnotowali liczbę epizodów wymiotnych i czas ich wystąpienia. W obu tych punktach czasowych pacjenci ocenili doustnie najgorszy epizod nudności w poprzednim przedziale w 11-punktowej skali, gdzie 0 nie oznaczało nudności, a 10 - najpoważniejszych nudności. Analiza statystyc...

Więcej »

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700...

Więcej »

In vitro wywołane antygenem odpowiedzi przeciwciał na antygen powierzchniowy wirusa zapalenia wątroby typu B u człowieka. Wymagania kinetyczne i komórkowe.

W niniejszym raporcie definiujemy parametry ludzkiej odpowiedzi immunologicznej po immunizacji szczepionką przeciw wirusowemu zapaleniu wątroby typu B. 2 tygodnie po immunizacji przypominającej stwierdzono znaczne spontaniczne wydzielanie przeciwciała do antygenu powierzchniowego wirusa zapalenia wątroby typu B (anty-HBs IgG), które nie jest dodatkowo wzmacniane przez stymulację antygenem lub mitogenem szkarłatki (PWM). Do 4 t...

Więcej »

Everolimus w zaawansowanym raku piersi pozaplanowym hormonem receptora dodatnim AD 2

Uważa się, że białka żółciowe hamujące lub promujące krystalizację cholesterolu odgrywają główną rolę w patogenezie cholesterolu w żółciowej kamicy. Zgłaszamy teraz nową grupę białek żółciowych, które wiążą się z kryształami cholesterolu, modyfikują morfologię kryształów i hamują krystalizację cholesterolu. Różne mieszaniny glikoprotein wyekstrahowano z nieprawidłowej żółciowej woreczka żó...

Więcej »

Notice: Undefined offset: 1 in /home/hydra15/ftp/5dniwojny.pl/media/index.php on line 277

Notice: Undefined offset: 1 in /home/hydra15/ftp/5dniwojny.pl/media/index.php on line 280
751#metody na zaparcia , #pompki na krzesłach , #bransoletki rossmann , #8 gb to mb , #skala cattella , #mocne tabletki przeciwbólowe , #endokrynolog zielona góra prywatnie , #ciśnienie gałki ocznej , #widzenie przez mgłę , #toksoplazmoza igg dodatnie ,