Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700 Sequence Detection Analyzer (Applied Biosystems). Wszystkie próbki DNA poddano również ilościowej PCR w czasie rzeczywistym dla genu .-globiny, który służył jako kontrola w zakresie, w jakim DNA plazmatyczne może być amplifikowane. W każdej analizie uwzględniono wiele pustych przestrzeni jako kontrolę negatywną. PCR EBV i .-globiny przeprowadzono trzykrotnie. Krzywą kalibracji prowadzono równolegle i w dwóch powtórzeniach dla każdej analizy z użyciem DNA wyekstrahowanego z linii komórek EBV-dodatnich, Namalwa (American Type Culture Collection, numer CRL-1432), jako wzorca. Stężenia DNA EBV w osoczu wyrażono jako liczbę kopii genomu EBV na mililitr osocza. 17 Próbki z niewykrywalnym sygnałem EBV po przetworzeniu w warunkach ilościowego PCR w czasie rzeczywistym (40 cykli) uznawano za zero kopii. Wpisywanie DNA EBV w sparowane próbki osocza i guza
W niektórych przypadkach sparowane próbki DNA z guza pierwotnego i osocza od tego samego pacjenta zostały losowo wybrane i poddane jakościowej PCR z użyciem starterów specyficznych dla utajonego białka błonowego (LMP-1) i antygenu jądrowego EBC 3C (EBNA- 3C). Przeprowadzono bezpośrednie sekwencjonowanie produktów PCR z guza pierwotnego i osocza w celu weryfikacji.
Analiza statystyczna
Czas przeżycia bez nawrotów obliczono od pierwszego dnia chemioterapii do daty nawrotu lub ostatniej wizyty kontrolnej. Całkowite przeżycie obliczono od pierwszego dnia chemioterapii do śmierci lub ostatniej wizyty kontrolnej. Szacowanie czasu życia przeprowadzono zgodnie z metodą Kaplana i Meiera. Jednariariatowe porównanie krzywych przeżycia przeprowadzono za pomocą testu log-rank. Wielowymiarowy model proporcjonalnego hazardu Coxa zastosowano do oszacowania współczynników ryzyka i 95-procentowych przedziałów ufności. Zmienne w modelu obejmowały: wiek, płeć, status sprawności Karnofsky ego, typ patologiczny według Światowej Organizacji Zdrowia, odpowiedź na chemioterapię, etap T, stadium węzłowe (N), stadium ogólne, stężenie DNA EBV w surowicy przed leczeniem i poziom DNA EBV w osoczu tydzień po zakończeniu leczenia. Związek pomiędzy stężeniem DNA EBV w osoczu a szybkością nawrotu oceniano za pomocą testu chi-kwadrat. Stężenia DNA EBV w osoczu porównano z testem sumy rang Manna-Whitneya dla kategorii binarnych lub testu Kruskala-Wallisa dla więcej niż dwóch kategorii. Wszystkie testy statystyczne były dwustronne, a wartość P mniejsza niż 0,05 została uznana za wskazującą na istotność statystyczną. Analizy przeprowadzono przy użyciu oprogramowania SAS (wersja 8.0, SAS Institute).
Wyniki
Charakterystyka przed leczeniem i wyniki kliniczne
Tabela 1. Tabela 1. Charakterystyka 99 pacjentów
[podobne: alprazolam, dienogest, ambroksol ]
[patrz też: uchyłki w esicy, ucisk worka oponowego, udar pnia mózgu rokowania ]