Skuteczność terapii celowanej komórkami B z Rytuksymabem u pacjentów z reumatoidalnym zapaleniem stawów ad

CD20 jest antygenem powierzchniowym komórek B, który jest eksprymowany tylko na pre-B i dojrzałych komórkach B. Nie jest obecny na komórkach macierzystych i jest tracony przed różnicowaniem komórek B w komórki plazmatyczne. Dlatego rytuksymab powoduje selektywne przejściowe zubożenie subpopulacji komórek B CD20 +. Aby potwierdzić rolę komórek B w reumatoidalnym zapaleniu stawów, oceniliśmy wpływ rytuksymabu u pacjentów z aktywnym reumatoidalnym zapaleniem stawów w wieloośrodkowym, randomizowanym, podwójnie ślepym, kontrolowane badanie. Metody
Pacjenci
Pacjenci byli rekrutowani z 26 ośrodków reumatologicznych w 11 krajach (Australii, Kanadzie, Izraelu i 8 krajach europejskich). Read more „Skuteczność terapii celowanej komórkami B z Rytuksymabem u pacjentów z reumatoidalnym zapaleniem stawów ad”

Brak działania liposukcji na działanie insuliny i czynniki ryzyka choroby niedokrwiennej serca

Liposukcja została zaproponowana jako potencjalne leczenie powikłań metabolicznych związanych z otyłością. Oceniliśmy wpływ liposukcji jamy brzusznej dużej objętości na metaboliczne czynniki ryzyka choroby niedokrwiennej serca u kobiet z otyłością brzuszną. Metody
Oceniliśmy wrażliwość na insulinę wątroby, mięśni szkieletowych i tkanki tłuszczowej (z zastosowaniem procedury zacisku euglikemiczno-hiperinsulinemicznego i wlewów izotopowo-znacznikowych), a także stężenia mediatorów stanu zapalnego i innych czynników ryzyka choroby wieńcowej u 15 otyłych kobiet przed i 10 lat. do 12 tygodni po liposukcji brzusznej. Osiem kobiet miało prawidłową tolerancję glukozy (średni [. Read more „Brak działania liposukcji na działanie insuliny i czynniki ryzyka choroby niedokrwiennej serca”

Infekcje Clostridium związane z alloprzeszczepami mięśniowo-szkieletowymi

Alloprzeszczepy są powszechnie stosowane w chirurgii rekonstrukcyjnej ortopedycznej. W 2001 r. Około 775 000 alloprzeszczepów mięśniowo-szkieletowych zostało rozprowadzonych przez amerykańskie banki tkanek. Po śmierci z powodu sepsy Clostridium sordellii 23-letniego mężczyzny, który otrzymał skażony allograft z banku tkanek (Tissue Bank A), Centers for Disease Control and Prevention zainicjowały badanie, w tym udoskonalone ustalenie przypadku, metod wykorzystywane do odzyskiwania, przetwarzania i testowania tkanki. Metody
Przypadek infekcji clostridium związanej z aloprzeszczepem został zdefiniowany jako potwierdzona kulturowo infekcja miejsca operacyjnego w ciągu jednego roku po wszczepieniu alloprzeszczepu, od stycznia 1998 r. Read more „Infekcje Clostridium związane z alloprzeszczepami mięśniowo-szkieletowymi”

Ból w karku

W artykule Clinical Problem-Solving autorstwa Bliss i in. (Wydanie 4 marca), które dotyczyło zespołu Lemierre a, dyskutant wspomina o wysięku migdałkowym pacjenta, gorączce, adenopatii przedniej szyjki macicy i braku kaszlu. . . są wysoce sugerujące paciorkowcowe zapalenie gardła i że należy uzyskać wymaz z jej gardła w celu szybkiego testu antygenu paciorkowcowego . Read more „Ból w karku”

Wywołane lekiem wydłużenie odstępu QT

Roden (wydanie 4 marca) przedstawia zwięzłą recenzję indukowanego lekiem wydłużenia odstępu QT. Jednak w Tabeli 2 artykułu, który wymienia czynniki ryzyka dla torsade de pointes, dieta i post nie są wymienione. Było kilka doniesień o przedłużeniu odstępu QT i związanych z nim torsade de pointes wynikających z diet oszczędzających białko, głodzenia, jadłowstrętu psychicznego i postu podczas strajku głodowego.2-5 W konsekwencji lekarze powinni zwracać szczególną uwagę przy przepisywaniu odstępu QT – w takich okolicznościach leki przedłużające życie u pacjentów.
Panagiotis Korantzopoulos, MD
Konstantinos Siogas, MD
G. Hatzikosta General Hospital of Ioannina, 45001 Ioannina, Grecja
[email protected] gr
5 Referencje1. Read more „Wywołane lekiem wydłużenie odstępu QT”

Próba trzech schematów antyretrowirusowych u dzieci zarażonych HIV-1 ad 5

Zaobserwowano istotną różnicę między schematami wyjściowych poziomów RNA HIV-1 (P = 0,04). Jednakże dzieci otrzymujące schemat stawudyny, lamiwudyny, newirapiny i nelfinawiru miały najwyższy wyjściowy poziom RNA HIV-1 (średnia, 5,6 log na mililitr). Tak więc kolejna przewaga tego schematu była widoczna pomimo wyższego wyjściowego miana wirusa. Ostateczny test na potencjalną konfrontację polegał na modelach logistyczno-regresyjnych z supresją wirusową w tygodniach 16, 48 i 200 jako zmiennych wynikowych i predykcyjnych składających się z reżimu leczenia i potencjalnych czynników zakłócających wymienionych powyżej. Wyjściowy poziom prowirusowego DNA został wykluczony z tych modeli, ponieważ nie mierzono go u dzieci, które otrzymywały schemat trzech leków i nie był znaczącym predyktorem sukcesu wirusologicznego dla dwóch pozostałych schematów. Read more „Próba trzech schematów antyretrowirusowych u dzieci zarażonych HIV-1 ad 5”

Factorial Trial z sześciu interwencji w celu zapobiegania pooperacyjnych nudności i wymiotów czesc 4

Po 2 i 24 godzinach po operacji, przeszkoleni badacze, którzy byli całkowicie zaślepieni śródoperacyjnym zarządzaniem i losowymi zadaniami leczenia, odnotowali liczbę epizodów wymiotnych i czas ich wystąpienia. W obu tych punktach czasowych pacjenci ocenili doustnie najgorszy epizod nudności w poprzednim przedziale w 11-punktowej skali, gdzie 0 nie oznaczało nudności, a 10 – najpoważniejszych nudności. Analiza statystyczna
Przeprowadzono różne szacunki wielkości próby i wskazano, że około 5000 pacjentów będzie potrzebnych do analizy interakcji obejmujących aż trzy czynniki, podczas gdy liczba pacjentów wymagana do analizy oddziaływań dwuczynnikowych lub pojedynczych czynników była znacznie mniejsza. 20 Interakcja została zdefiniowana jako obecna, jeśli wpływ dwóch czynników w połączeniu był znacząco różny od oddzielnego wpływu każdego czynnika pomnożonego razem w skali prawdopodobieństwa.
Dla każdej z sześciu randomizowanych terapii porównano liczbę pacjentów, którzy mieli pooperacyjne nudności i wymioty, z użyciem testów chi-kwadrat dla każdego głównego efektu i oszacowano zmniejszenie względnego ryzyka nudności i wymiotów. Read more „Factorial Trial z sześciu interwencji w celu zapobiegania pooperacyjnych nudności i wymiotów czesc 4”

Nieinwazyjna wentylacja z dodatnim ciśnieniem w przypadku niewydolności oddechowej po ekstubacji cd

Zadania zostały wykonane przy użyciu tabeli liczb losowych i nieprzezroczystych, zapieczętowanych, ponumerowanych kopert. Randomizację przeprowadzono przy zmiennych wielkościach bloków i stratyfikowano zgodnie z ośrodkiem badania i obecnością lub nieobecnością przewlekłej obturacyjnej choroby płuc. Standardowa terapia medyczna
Pacjenci przydzieleni do grupy leczenia standardowego otrzymywali suplementację tlenową, fizjoterapię oddechową, leki rozszerzające oskrzela i wszelkie inne terapie zgodnie z zaleceniami lekarza prowadzącego. Pacjenci ci mogli być ponownie naświetleni lub przekierowani w celu uzyskania nieinwazyjnej wentylacji, jeśli spełnili wcześniej określone kryteria reaktywacji (opisane poniżej). W tej grupie uznano, że zastosowanie nieinwazyjnej wentylacji wskazuje, że standardowa terapia medyczna zawiodła. Read more „Nieinwazyjna wentylacja z dodatnim ciśnieniem w przypadku niewydolności oddechowej po ekstubacji cd”

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700 Sequence Detection Analyzer (Applied Biosystems). Wszystkie próbki DNA poddano również ilościowej PCR w czasie rzeczywistym dla genu .-globiny, który służył jako kontrola w zakresie, w jakim DNA plazmatyczne może być amplifikowane. Read more „Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd”

Pneumocystis Zapalenie płuc ad

Rentgenowska radiografia klatki piersiowej u 68-letniego pacjenta z zapaleniem płuc wywołanym przez zapalenie płuc, które rozwinęło się jako następstwo długotrwałej terapii kortykosteroidami w neuropatii zapalnej. Mieszane nacieki pęcherzykowe i śródmiąższowe są bardziej widoczne po prawej stronie niż po lewej stronie. Typowymi cechami radiologicznymi zapalenia płuc typu pneumocystis są obustronne śródmiąższowe nacieki śródmiąższowe, które stają się coraz bardziej jednorodne i rozpraszają się wraz z postępem choroby (ryc. 1) .14 Mniej powszechne odkrycia obejmują pojedyncze lub wielokrotne guzki, nacieki górnych płatów u pacjentów otrzymujących aerozolu pentamidynę, pneumatocele i odma opłucnowa . Wysięk opłucnowy i limfadenopatia klatki piersiowej są rzadkie. Read more „Pneumocystis Zapalenie płuc ad”