Próba trzech schematów antyretrowirusowych u dzieci zarażonych HIV-1 ad 5

Zaobserwowano istotną różnicę między schematami wyjściowych poziomów RNA HIV-1 (P = 0,04). Jednakże dzieci otrzymujące schemat stawudyny, lamiwudyny, newirapiny i nelfinawiru miały najwyższy wyjściowy poziom RNA HIV-1 (średnia, 5,6 log na mililitr). Tak więc kolejna przewaga tego schematu była widoczna pomimo wyższego wyjściowego miana wirusa. Ostateczny test na potencjalną konfrontację polegał na modelach logistyczno-regresyjnych z supresją wirusową w tygodniach 16, 48 i 200 jako zmiennych wynikowych i predykcyjnych składających się z reżimu leczenia i potencjalnych czynników zakłócających wymienionych powyżej. Wyjściowy poziom prowirusowego DNA został wykluczony z tych modeli, ponieważ nie mierzono go u dzieci, które otrzymywały schemat trzech leków i nie był znaczącym predyktorem sukcesu wirusologicznego dla dwóch pozostałych schematów. Read more „Próba trzech schematów antyretrowirusowych u dzieci zarażonych HIV-1 ad 5”

Factorial Trial z sześciu interwencji w celu zapobiegania pooperacyjnych nudności i wymiotów czesc 4

Po 2 i 24 godzinach po operacji, przeszkoleni badacze, którzy byli całkowicie zaślepieni śródoperacyjnym zarządzaniem i losowymi zadaniami leczenia, odnotowali liczbę epizodów wymiotnych i czas ich wystąpienia. W obu tych punktach czasowych pacjenci ocenili doustnie najgorszy epizod nudności w poprzednim przedziale w 11-punktowej skali, gdzie 0 nie oznaczało nudności, a 10 – najpoważniejszych nudności. Analiza statystyczna
Przeprowadzono różne szacunki wielkości próby i wskazano, że około 5000 pacjentów będzie potrzebnych do analizy interakcji obejmujących aż trzy czynniki, podczas gdy liczba pacjentów wymagana do analizy oddziaływań dwuczynnikowych lub pojedynczych czynników była znacznie mniejsza. 20 Interakcja została zdefiniowana jako obecna, jeśli wpływ dwóch czynników w połączeniu był znacząco różny od oddzielnego wpływu każdego czynnika pomnożonego razem w skali prawdopodobieństwa.
Dla każdej z sześciu randomizowanych terapii porównano liczbę pacjentów, którzy mieli pooperacyjne nudności i wymioty, z użyciem testów chi-kwadrat dla każdego głównego efektu i oszacowano zmniejszenie względnego ryzyka nudności i wymiotów. Read more „Factorial Trial z sześciu interwencji w celu zapobiegania pooperacyjnych nudności i wymiotów czesc 4”

Nieinwazyjna wentylacja z dodatnim ciśnieniem w przypadku niewydolności oddechowej po ekstubacji cd

Zadania zostały wykonane przy użyciu tabeli liczb losowych i nieprzezroczystych, zapieczętowanych, ponumerowanych kopert. Randomizację przeprowadzono przy zmiennych wielkościach bloków i stratyfikowano zgodnie z ośrodkiem badania i obecnością lub nieobecnością przewlekłej obturacyjnej choroby płuc. Standardowa terapia medyczna
Pacjenci przydzieleni do grupy leczenia standardowego otrzymywali suplementację tlenową, fizjoterapię oddechową, leki rozszerzające oskrzela i wszelkie inne terapie zgodnie z zaleceniami lekarza prowadzącego. Pacjenci ci mogli być ponownie naświetleni lub przekierowani w celu uzyskania nieinwazyjnej wentylacji, jeśli spełnili wcześniej określone kryteria reaktywacji (opisane poniżej). W tej grupie uznano, że zastosowanie nieinwazyjnej wentylacji wskazuje, że standardowa terapia medyczna zawiodła. Read more „Nieinwazyjna wentylacja z dodatnim ciśnieniem w przypadku niewydolności oddechowej po ekstubacji cd”

Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd

Sekwencje starterów do przodu i do tyłu były odpowiednio 5 CCCAACACTCCACCACACC3 i 5 TCTTAGGAGCTGTCCGAGGG3 . Znakowany podwójnie fluorescencyjnie oligomer, 5 (FAM) CACACACTACACACACCCACCCGTCTC (TAMRA) 3 służył jako sonda. W teście ilościowym PCR w czasie rzeczywistym (40 cykli) i procedurach konfiguracji reakcji opisano szczegółowo poprzednio 17. PCR ilościowy w czasie rzeczywistym przeprowadzono za pomocą ABI Prism 7700 Sequence Detection Analyzer (Applied Biosystems). Wszystkie próbki DNA poddano również ilościowej PCR w czasie rzeczywistym dla genu .-globiny, który służył jako kontrola w zakresie, w jakim DNA plazmatyczne może być amplifikowane. Read more „Oznaczenie ilościowe DNA wirusa Epsteina-Barra w osoczu u pacjentów z zaawansowanym rakiem nosogardzieli cd”

Pneumocystis Zapalenie płuc ad

Rentgenowska radiografia klatki piersiowej u 68-letniego pacjenta z zapaleniem płuc wywołanym przez zapalenie płuc, które rozwinęło się jako następstwo długotrwałej terapii kortykosteroidami w neuropatii zapalnej. Mieszane nacieki pęcherzykowe i śródmiąższowe są bardziej widoczne po prawej stronie niż po lewej stronie. Typowymi cechami radiologicznymi zapalenia płuc typu pneumocystis są obustronne śródmiąższowe nacieki śródmiąższowe, które stają się coraz bardziej jednorodne i rozpraszają się wraz z postępem choroby (ryc. 1) .14 Mniej powszechne odkrycia obejmują pojedyncze lub wielokrotne guzki, nacieki górnych płatów u pacjentów otrzymujących aerozolu pentamidynę, pneumatocele i odma opłucnowa . Wysięk opłucnowy i limfadenopatia klatki piersiowej są rzadkie. Read more „Pneumocystis Zapalenie płuc ad”